ssuis.mlst.net
Streptococcus suis - Organismal Information
http://ssuis.mlst.net/misc/info.asp
Primers and PCR conditions for MLST of S.suis. Internal fragments of the 5-enolpyruvylshikimate 3-phosphate synthase (aroA), 60 KDa chaperonin (cpn60), peroxide resistance (dpr), glucose kinase (gki), DNA mismatch repair protein (mutS), homologous recombination factor (recA) and aspartokinase (thrA) genes were amplified by PCR using the following primer pairs. AroA-up 5’ TTCCATGTGCTTGAGTCGCTA 3’ and. AroA-dn 5’ ACGTGACCTACCTCCGTTGAC 3’. Cpn-up 5’ TTGAAAAACGTRACKGCAGGTGC 3’and. King, S.J., Leigh, ...The S...
bhenselae.mlst.net
MLST - Unique profile treedraw
http://bhenselae.mlst.net/eburstv3
New features in eBURSTv3 are as follows -. JAVA Webstart implementation -allowing local install. Implementation of MultilocusML allowing comprehensive database integration and querying based on eBURST groups. Ability to upload and differentially display user strains against strains within the. Please make a choice -. Run eBURST on the entire. Enter your own profile data for direct comparison against database strains. To download the entire eBURST readme as .pdf.
bhenselae.mlst.net
MLST - Unique profile treedraw
http://bhenselae.mlst.net/sql/uniquetree.asp
Draw tree using own MLST data. For Instructions click -. Paste your data in comma-delimited format as follows:-. Strain A,4,5,6,4,7,9,10,1. Strain B,1,1,2,4,3,3,18,7. Strain C,3,4,5,6,7,9,23,9. WARNING - You must have no spaces on either side of your data. Please submit the form once then click to draw a tree. Please enter your query -.
ssuis.mlst.net
ST's as HTML
http://ssuis.mlst.net/sql/refset.asp
Compare your allelic profile to the reference set of ST's. Please enter your QUERY allelic profile in the following format - 1,2,3,4,5,6,7. Ie separated by commas). You must enter 7 digits or you will not be able to see a tree. To use the tree drawing program, please enable Java on your browser.
ukmirror1.pubmlst.org
MLST databases
http://ukmirror1.pubmlst.org/databases.shtml
All species MLST databases and published schemes. MLST databases are hosted at the University of Oxford, UK. Imperial College, London, UK. The University of Warwick, UK. And the Pasteur Institute, Paris, France. Order by: Organism Profiles. Chart shows databases with at least 1000 profiles or isolates. Data updated automatically: 2016-01-29. Website and link to database. Spilker et al. (2012) J Clin Microbiol. Isolate characterisation and population structure analysis. Population and evolutionary analyses.