crispr.i2bc.paris-saclay.fr
CRISPR home pageCRISPR home page
http://crispr.i2bc.paris-saclay.fr/
CRISPR home page
http://crispr.i2bc.paris-saclay.fr/
TODAY'S RATING
>1,000,000
Date Range
HIGHEST TRAFFIC ON
Saturday
LOAD TIME
0.7 seconds
PAGES IN
THIS WEBSITE
8
SSL
EXTERNAL LINKS
2
SITE IP
129.175.104.57
LOAD TIME
0.719 sec
SCORE
6.2
CRISPR home page | crispr.i2bc.paris-saclay.fr Reviews
https://crispr.i2bc.paris-saclay.fr
CRISPR home page
crispr.i2bc.paris-saclay.fr
CRISPRtionary
http://crispr.i2bc.paris-saclay.fr/CRISPRcompar/Dict/Dict.php
CRISPRtionary : Dictionary Creator. Upload your spacers dictionary. The spacers dictionary is an excel formatted file with a specific format (see an exemple here. A dictionary, containing the spacers identified in the submitted sequences, will be created by the program if you dont specify any at this stage. Enter CRISPRs sequences (fasta formatted) from which your want to compar the spacers arrangement. The sequences are supposed to contains allelic CRISPRs. Or enter sequences below using copy and paste:.
CRISPRs Database - Help
http://crispr.i2bc.paris-saclay.fr/crispr/HelpTopics/help_CRISPRdatabase.html
CRISPRs Web service User's manual. A number of tools are available here:. Itself, in which microbial genomes have been pre-processed in search for CRISPRs structures. This database can be browsed in an intuitive way. The second tool is the crispr finder tool. You can use this page to analyse your own data. The BLAST CRISPR page. Allows you to store your own data. Your data will be available together with that of the main database for comparison with the CRISPRcompar tool. And CRISPR YP1 Pestis. The first...
CRISPRs Finder online
http://crispr.i2bc.paris-saclay.fr/Server
Cas Genes at TIGR. CRISPR plasmids for academic lab research at Addgene. CRISPR evolution ( Yersinia pestis. CRISPRs found ( *. Number of convincing CRISPR structures (number of genomes with such CRISPR). Welcome to the CRISPRs web service. This page enables the easy detection of CRISPRs. In user-submitted sequence data (allows sequences up to 67,000,000 bp). Your data must be a DNA sequence (or many DNA sequences) in FASTA. Download sample1 Aquifex VF5. Or sample2 P. aeruginosa PA14. Submit your Own data.
Blast against the CRISPR database
http://crispr.i2bc.paris-saclay.fr/crispr/BLAST/CRISPRsBlast.php
Blast against the CRISPR database. Enter the sequence to blast (sequence should be in Fasta format):. Select a database to blast against.
CRISPRcompar
http://crispr.i2bc.paris-saclay.fr/CRISPRcompar
The CRISPRcompar program automatically recovers from CRISPRdb all members of a genus containing a CRISPR and proposes to compare each of them using an alphabetic list of strains harbouring a CRISPR (alternatively, all strains from a given genus can be selected at once using the "strain taxonomy browser"). To compare unpublished sequences and genomes, a private database on the model of CRISPRdb must first be created (use your email adress and a 6 digits password).
TOTAL PAGES IN THIS WEBSITE
8
eBIO : Plate-forme de bioinformatique Université Paris Sud
http://ebio.u-psud.fr/eBIO_BDD.php
Base de données de génotypage pour différents microorganismes. I Grissa, P Bouchon, C Pourcel and G Vergnaud. On-line resources for bacterial micro-evolution studies using MLVA or CRISPR typing. Biochimie Volume 90, Issue 4, April 2008;660-668. Service Web pour la recherche sans effort des gènes procaryotes et de leur séquence. Web server for the effortless retrieval of prokaryotic gene context and sequence. Descorps-Declère S, Barba M, Labedan B. Matching curated genome databases: a non trivial task.
TOTAL LINKS TO THIS WEBSITE
2
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
CRISPR-on Home
Read the Article (open access). This is the homepage of CRISPR-on, an RNA-guided transcriptional activator created in the Jaenisch Lab. AOP Aug 27, 2013 Article (Open Access). This page is maintained by Albert Cheng. And is under-construction. We are working with Addgene to complete the collection of plasmids. Read the Article (Open Access). Select plasmids - Plasmid Selection Guide. Get the plasmids - Addgene Page.
CRISPRdirect
Mdash; Rational design of CRISPR/Cas target. Or Paste a nucleotide sequence:. Sample sequence atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatg...
CRISPR home page
Cas Genes at TIGR. CRISPR plasmids for academic lab research at Addgene. CRISPR evolution ( Yersinia pestis. CRISPRs found ( *. Number of convincing CRISPR structures (number of genomes with such CRISPR). This web site is the product of an original work by Ibtissem Grissa ( PhD thesis Paris University. And is presently developed by Christine Drevet. A web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007 May 31. General purpose of this site. Itself, in wh...
sgRNA Scorer 1.0
Church lab CRISPR resources. SgRNA Scorer 1.0. SgRNA Scorer 1.0. We have also made available a pre-computed list of sites derived using CasFinder and scored with sgRNA Scorer for the entire human and mouse exomes for both Cas9 orthologs. This can be found here. Please use a working e-mail address as a link to a file with results from sgRNA scorer will be emailed to you as soon as it's done. The file will be retained for 24 hours. S pyogenes (PAM: NGG). S thermophilus (PAM: NNAGAAW).
CRISPR/Cas gRNA Designs
Order Oligos and Peptides. Product and Process Development. Safety and Regulatory Information. New Lab Start-Up Program. Search CRISPR/Cas gRNA designs. Review and Email Order. Ordering and Design Guidelines. 1) Search by Gene Symbol, mRNA RefSeq, or Gene ID. 2) Searches are performed on the highlighted tab only. 3) Search for up to 10 terms at one time. Option 1 : Enter Gene Symbol(s). Option 2 : Upload from template. Option 1 : Enter RefSeqs(s). Option 2 : Upload from template. We recommend screening 4...
Maintenance
Le site est desormais accessible a l'adresse suivante :. Http:/ crispr.i2bc.paris-saclay.fr.
crispr.us - This website is for sale! - crispr Resources and Information.
The domain crispr.us. May be for sale by its owner! This page provided to the domain owner free. By Sedo's Domain Parking. Disclaimer: Domain owner and Sedo maintain no relationship with third party advertisers. Reference to any specific service or trade mark is not controlled by Sedo or domain owner and does not constitute or imply its association, endorsement or recommendation.
CRISPR Conference 2015
John van der Oost. The Adaptive Prokaryotic Immune System CRISPR-Cas. The Carson Family Auditorium. New York, NY 10065. 18 - 20 June 2015. University of Massachusetts Medical School. New York, NY.
